게시판 뷰
게시판 뷰페이지
1-3. Polymerase Chain Reaction (PCR)
작성자 안홍선
날짜 2009.05.12
조회수 4,837
Polymerase chain reaction(PCR, 중합효소 연쇄반응)은 이미 염기서열을 일부 알고 있는 유전자를 증폭하는
방법입니다. PCR 실험 방법에 대하여 더 자세한 것을 보시려면 이 홈페이지의 가이드북 중에서 [PCR]
편을 참조하시기 바랍니다. 여기에서는 간단히 설영하겠습니다.

PCR에는 다음과 같은 재료가 필요합니다.

Template DNA : 증폭 대상이 되는 DNA 입니다.
한 쌍의 primer : 증폭할 부분을 잡는 짧은
dNTP(dATP, dCTP, dGTP, dTTP) : 유전자를 합성하는 재료가 되는
Taq polymerase : 열에 특별히 강한 유전자 합성효소입니다.

다음 과정이 계속 반복하여 진행되면서(보통 25∼35회) 원하는 DNA 부분을 증폭시키는 것이 PCR 의 원리입니다.

쉽게 설명하면 튜브에 재료를 집어넣고 뜨겁게 덥혔다 식혔다 하면(이건 기계가 알아서 해 줍니다) Taq polymerase 가 알아서
유전자를 합성해주는 것입니다.

1. DNA 의 변성(denaturation)

90°C - 96°C로 가열하여 double strand DNA(ds DNA)를 single strand DNA(ssDNA)로
분리시킵니다. 높은 온도일수록 ssDNA 로 잘 이행되지만 Taq DNA polymerase도 온도가 아주 높은 상태에서는 활성이 낮아질 수
있으므로 보통 94°C로 합니다. 첫 cycle에서는 확실한 변성을 위하여 약 5분간 지속시킵니다.

2. Primer 의 결합(annealing)

50°C - 65°C에서 진행됩니다. 염기간의 결합은 G와 C는 세군데에서 수소결합이 일어나고, A와 T는 두군데에서 결합이 일어나므로
G+C 비율에 따라 결합온도에 변화를 주는 것이 좋습니다. 사실 primer 를 만드는 것도 이 annealing temperature를
고려하여 합성해야 합니다. 일반적으로 GC content 가 50%가 되는 primer 쌍을 이용하는 것이 바람직합니다.

3. DNA의 합성(polymerization)

70°C - 74°C에서 시행하며 원하는 PCR 산물의 크기가 크거나 반응요소의 농도가 낮을 때에는 시간을 연장시킬 수도 있습니다. Taq
DNA polymerase는 보통 1분에 2,000-4,000 nucleotides를 합성할 수 있으므로 원하는 PCR 산물의 크기 1 kb마다
1분 정도의 시간을 배당하면 충분히 반응이 일어납니다. 마지막 cycle 에는 약 10분 정도 시간을 충분히 주는 것이 좋겠습니다.


잘 실감이 안나시면 PCR animation 프로그램 실행시켜보시기 바랍니다. 이 프로그램은 href="http://vector.cshl.org/Shockwave/pcranwhole.html" target=_blank>The DNA
Learning Center
에 있습니다.

다음은 대표적인 PCR mixture의 예입니다.

example of PCR mix

DNA template 1 ul
Primer, upstream(10 pmoles/ul) 1 ul
Primer, downstream(10 pmoles/ul) 1 ul
2.5 mM dNTP 4 ul
10x Taq buffer 5 ul
Taq DNA polymerase(1 u/ul) 1 ul

water to 50 ul

example of PCR cycle

94°C 5분
94°C 30초 - 60°C 30초 - 72°C 30초 (30 cycle)
72°C 5분

Primer의 디자인

이 홈페이지가 웹에 올려진 다음 많은 사람으로부터 질문을 받았는데, 가장 많은 것이 PCR을 할 때 primer를 어떻게 선정해야
하는가라는 문제였습니다. 일정한 원칙이 있다고 보기는 힘들어도 이 자리에 대략 설명하겠습니다. 우리가 GenBank에서 찾은 p53의 DNA
sequence는 아래와 같았습니다.

style="FONT-SIZE: 9pt">        1
gtctagagcc accgtccagg gagcaggtag ctgctgggct ccggggacac
       61 ggctgggagc gtgctttcca
cgacggtgac acgcttccct ggattggcag
      121 ttccgggtca
style="FONT-SIZE: 9pt">atgstyle="FONT-SIZE: 9pt">ga ggagccgcag tcagatccta gcgtcgagcc
      181 caggaaacat tttcagacct
atggaaacta cttcctgaaa acaacgttct
      241 ccgtcccaag caatggatga
tttgatgctg tccccggacg atattgaaca
      301 gaagacccag gtccagatga
agctcccaga atgccagagg ctgctccccc
      361 gcaccagcag ctcctacacc
ggcggcccct gcaccagccc cctcctggcc
      421 tctgtccctt cccagaaaac
ctaccagggc agctacggtt tccgtctggg
      481 tctgggacag ccaagtctgt
gacttgcacg tactcccctg ccctcaacaa
      541 caactggcca agacctgccc
tgtgcagctg tgggttgatt ccacaccccc
      601 cgcgtccgcg ccatggccat
ctacaagcag tcacagcaca tgacggaggt
      661 tgcccccacc atgagcgctg
ctcagatagc gatggtctgg cccctcctca
      721 cgagtggaag gaaatttgcg
tgtggagtat ttggatgaca gaaacacttt tcgac
color=green>style="FONT-SIZE: 9pt">atagt
gtggtggtgc cctat
style="FONT-SIZE: 9pt">gagcc gcctgaggtt ggctctgact gtaccaccat
      841 tacatgtgta acagttcctg
catgggcggc atgaaccgga ggcccatcct
      901 acactggaag actccagtgg
taatctactg ggacggaaca gctttgaggt
      961 gcctgtcctg ggagagaccg
style="FONT-SIZE: 9pt">ag gaagagaatc tccgcaagface="Courier New">aa
     1021 caccacgagc tgcccccagg
gagcactaag cgagcactgc ccaacaacac
     1081 ccccagccaa agaagaaacc
actggatgga gaatatttca cccttcagat
     1141 gagcgcttcg agatgttccg
agagctgaat gaggccttgg aactcaagga
     1201 gggaaggagc caggggggag
cagggctcac tccagccacc tgaagtccaa
     1261 tctacctccc gccataaaaa
actcatgttc aagacagaag ggcctgactc agac

여기에서 우리가 실험에서 증폭할 부위는 녹색과 청색으로 표시한 부위이며, 그 중 증폭에 사용할 primer 부위가 녹색입니다. 왜 이렇게
정했는지와 실험의 목적에 따라서 어떻게 디자인하는지를 설명하겠습니다. 조금 어려울 수도 있는 부분입니다.

1) 관심있는 부분이 포함되어야 한다

만약에 필요한 부분이 ORF라고 해 봅시다. 대개 단백질의 expression을 위해서는 ORF 전체가 필요하게 됩니다. 이 경우 관심있는
부분은 ATG initiation codon으로부터 TGA termination codon이 됩니다. 따라서 primer는 두 codon을
포함하든지 아니면 그보다 바깥 쪽에서 선정되어야 합니다. PCR에서 증폭되는 부분은 두 primer를 포함한 가운데 부분이기 때문입니다.

여기에서는 우리가 찾을 돌연변위 부위가 잘 발생한다고 알려진 부분을 고려해서 위와 같이 중간 쯤에서 primer를 선정한 것입니다.

2) 증폭하려는 부위의 크기를 고려해야 한다

RT-PCR에서는 위에서 말한 것처럼 단백질의 expression을 위해서 ORF 전체가 필요한 경우도 있지만, 대개는 어떤 mRNA가
존재하는지의 조사를 위해서 하는 경우가 많습니다. 이렇게 존재 유무를 검사하는 경우는 필요없이 길게 PCR 할 필요가 없겠지요. ORF 전체가
목표인 경우는 크기가 그냥 정해지지만 ORF의 일부만 detection 할 경우라면 대개 200 - 400 bp 정도를 PCR하는 것이
좋습니다. 가장 안정적으로 PCR이 되는 크기입니다.

위 염기서열에서 디자인한 primer를 쓰면 233 bp의 DNA가 증폭될 것입니다.

3) GC content와 primer length

관심있는 부위와 길이가 결정되었다면 염기서열을 살펴가면서 primer를 선정해봅니다. 그런데 이때 중요한 것은 G와 C의 비율, 그리고
primer의 길이입니다.
위에서도 설명했지만 염기간의 결합은 G와 C는 세군데에서 수소결합이 일어나고, A와 T는 두군데에서 결합이
일어납니다. 그러니까 primer의 길이가 길수록, 같은 길이라면 GC가 많을수록 primer와 template 사이에 형성되는 수소결합의 수가
많아집니다. 따라서 template를 denature 시킨 후에 온도를 낮추어 annealing이 되는 온도 시점은 수소결합의 수가 많을수록
높아지게 됩니다. 즉 온도를 적게 내려도 수소결합이 많으면 annealing이 되는 것이지요.
그러므로 primer의 선정시에 두
primer 사이에서 GC content와 length는 일치시키는 것이 좋겠습니다. 두 primer의 annealing temperature가
다르면 반응에 지장을 줄 수 있습니다.

물론 아무리 일치시키려고 해도 안되는 경우도 있지만 그런 경우를 제외하면 선정할 부분을 앞 뒤로 움직여가면서 GC content가 50%
내외, primer length가 20개 정도인 부분을 고르는 것이 좋습니다. 저는 대개 20mer(길이가 20 base라는 말입니다)의
primer에 GC가 9개-11개 정도인 것을 찾습니다.

이런 것을 이해하려면 Tm 값이라는 것을 알아야하는데, 더 자세한 것은 관련 서적을 참고해보시기 바랍니다. 여하튼 두 primer의 Tm
값을 일치시키는 것이 중요하다는 것을 말씀드립니다.

4) 이상한 염기서열은 피하라

기껏 위 원칙에 따라 선정하고보니 primer가 GGGGCCCCGGTTTTAATTAA라고 해 봅시다. 원칙에는 맞지만 도대체 반응이
되겠습니까  눈으로 살펴서라도 너무 이상한 염기서열은 피해야 합니다.
눈으로 확인하기는 어렵지만, primer 내부에서
annealing이 일어날 수 있는 염기서열도 피해야 합니다. 예를 들어 GGCAATT......AATTGCC라는 primer는 primer끼리
붙을 수도 있고 primer 내부에서 hairpin처럼 annealing 될 수도 있습니다. 이런 것 때문에 primer를 선정해 주는
프로그램도 나와 있습니다. 가능하다면 프로그램을 써서 디자인한 것을 검토해보는 것도 좋겠습니다. 하지만 프로그램으로 디자인하는 것도 위와 같은
원칙에 의한 것임을 명심하고 이런 내용을 알아야 한다는 것을 강조하고 싶습니다.

5) 합성될 때의 사정을 고려하라

이것도 조금 어려운 내용이지만, primer에 포함되지는 않았어도 증폭되는 부위에 너무 GC content가 높다거나 다른
secondary structure를 형성할 수 있는 부위가 있으면 잘 안될 것입니다. 특히 primer의 바로 downstream에
GGGGCCCCGGGCC... 와 같은 부위가 있지 않도록 디자인해야 합니다.

합성될 때를 가정해서 검토를 할 것이 또한가지 있습니다. 원칙에 따라 잘 디자인해놓은 primer의 염기서열이 재수없게 이 유전자에 또 한
부분 있다고 해 봅시다. 합성이 잘 되지 않겠지요.
수고스럽지만, 선정된 primer와 유사한 염기서열이 다른 부분에 존재하는지 유사성
검색을 해 볼 필요가 있습니다. 이것은 눈으로는 하기 힘들고 DNAstar나 VectorNTI 등을 이용해야 합니다.
이 유전자 말고 다른
유전자에 비슷한 부분이 있으면  이런 의문이 들 수도 있습니다. 사실 이런 것도 반응에 영향을 줄 수 있지만, 이 경우는 정말 재수없게
선정한 두 primer가 모두 쌍으로 비슷하지만 않으면 반응에 지대한 영향을 주지는 않을 것입니다. 하지만, 이런 마지막 고려 사항이 종종
장애가 됩니다.

Primer의 주문

style="FONT-SIZE: 9pt">      721 cgagtggaag
gaaatttgcg tgtggagtat ttggatgaca gaaacacttt tcgac
face="Courier New" color=green>style="FONT-SIZE: 9pt">atagt
gtggtggtgc cctat
style="FONT-SIZE: 9pt">gagcc gcctgaggtt ggctctgact gtaccaccat
      841 tacatgtgta acagttcctg
catgggcggc atgaaccgga ggcccatcct
      901 acactggaag actccagtgg
taatctactg ggacggaaca gctttgaggt
      961 gcctgtcctg ggagagaccg
style="FONT-SIZE: 9pt">ag gaagagaatc tccgcaagface="Courier New">aa aggggagcct

위와 같은 primer 부위를 선정하여 합성할 준비가 되었으면 올바른 염기서열을 적어서 합성해주는 회사에 보내면 됩니다. 해외로 주문할
수도 있고 국내에 주문할 수도 있습니다.

아래와 같은 양식(꼭 이런 양식을 쓸 필요는 없읍니다)에 primer 염기서열을 적어서 팩스로 보내면 됩니다. 항상 5' 에서 3'
방향으로 쓰게 되어 있으므로 upstream 과 downstream primer 의 방향을 잘 확인하고 씁니다. 그리고 염기 중 G는 알아보기
쉽도록 소문자 g로 쓰도록 되어 있습니다. 팩스로 받으면 G와 C가 헷갈리거든요. Service type이나 oligonucleotide
amount는 원하는대로 쓰고 purification type은 대부분 PAGE 까지는 필요없고 SEP-PAK 등 기본 정제면 충분합니다.

width=390 border=0>

위쪽 염기서열과 primer 주문서의 염기서열이 이해가 되십니까  Primer 서열이 잘못되었다고 생각하시는 분들은 다시 한 번
위로 가셔서 그림을 살펴보시기 바랍니다.

primer를 주문하면 아래 사진과 같이 작은 tube에 담겨 옵니다. 그리고 영수증 (거래명세서) 외에 왼쪽 사진처럼 primer의
내용이 써 있는 서류가 따라옵니다. Primer 의 농도와 순도가 어느 정도인가 써 있고 증명사진으로 electrophoresis까지 찍어서
줍니다. 오른쪽은 거래명세서 사진입니다. 이 글을 쓸 당시의 oligonucleotide의 주문 비용은 oligonucleotide 하나당 약
20,000원 정도였습니다. 이 비용은 조금씩 달라질 수 있습니다.

width=508 border=0>

Tube 속에는 말린 상태, 즉 lyophilized된 primer가 들어있습니다. 이를 TE, pH 8.0이나 distilled
water에 녹여서 쓰는데, 얼마에 녹이면 100 pmole/ul 짜리 stock이 되는지 종이에 써 있습니다. Primer는 얼려서

PCR 기계와 PCR 하는 실험 사진

PCR은 PCR tube라고도 부르는 아주 작은 0.2 ml tube를 이용하며, 특별한 기계를 사용합니다. 아래에서 구경하시지요. 기계가
하는 일은 그저 입력된 시간에 입력된 온도를 유지하는 것 뿐입니다. PCR 기계는 이제 냉장고 만큼이나 다양한 제품이 나와 있습니다.



